View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4417-Insertion-8 (Length: 272)
Name: NF4417-Insertion-8
Description: NF4417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4417-Insertion-8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 8 - 254
Target Start/End: Complemental strand, 36767690 - 36767445
Alignment:
| Q |
8 |
ggtgacacttcacaacaccattcatacgtttatccaaacttcaaccctagaacttcaatggaaactcgctcagacactagagactcaatttgtttcgtac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36767690 |
ggtgacacttcacaacaccattcatacgtttatccaaacttcaaccctagaacttcaatggaaact-gctcagacactagagactcaatttgtttcgtac |
36767592 |
T |
|
| Q |
108 |
ccgaatcttctttcgtttgtcgatctgaatcagttaaatcagttgggactagtgaagcctaaggatgagatgattggttctcaaaacaacaatgcaactt |
207 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36767591 |
ccgaatcttctttcgtttgtcgatttgaatcagttaaatcagttgggactagtgaagcctaaggatgagatgattggttctcaaaacaacaatgcaactt |
36767492 |
T |
|
| Q |
208 |
cttctgacatgatttctcaaggaacctttgaggccaaaaaggtagca |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36767491 |
cttctgacatgatttctcaaggaacctttgagaccaaaaaggtagca |
36767445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University