View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4417_low_5 (Length: 517)
Name: NF4417_low_5
Description: NF4417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4417_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 2e-96; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 215 - 506
Target Start/End: Complemental strand, 3354412 - 3354116
Alignment:
| Q |
215 |
aaactcatgaagatcatcatcatcatgaaaacatactttcttcttcaacttctcttaactcctatccttcctttccacctcatcaacactttcaaggtca |
314 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3354412 |
aaactcatgaagatcatcatcat---gaaaacatactttcttcttcaacttctcttaactcctatccttcctttccacctcatcaacactttcaaggtca |
3354316 |
T |
 |
| Q |
315 |
cactcaaacnnnnnnnngtgtgttaagttgcatttatatctgaagttacgctgcaaacttttatattg--nnnnnnnnnnngtgagactgatgtgatcaa |
412 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3354315 |
cactcaaacttttttttgtgtgttaagttgcatttatatctgaaattacgctgcaaacttttatattggaaaaaaaaaaaagtgagactgatgtgatcaa |
3354216 |
T |
 |
| Q |
413 |
aattgtgattgtaataccgttgcgaaaacctcaatatttgttatattatc------gattgcaatttaaaaccttgacaacaacatcctctctcttctct |
506 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3354215 |
aattgcgattgtaataccgttgcgagaacctcaatatttgttatattatcgttgcagattgcaatttaaaaccttgacaacaacatcctccctcttctct |
3354116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 65 - 150
Target Start/End: Complemental strand, 3354562 - 3354477
Alignment:
| Q |
65 |
agagaaatagaaaatgacccttatagctttatagctatacttttgcatgaataattctaatatcactacttccaatataccatatc |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3354562 |
agagaaatagaaaatgacccttatagctttatagctatacttttgcatgaataattctaatatcactacttccaatataccatatc |
3354477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University