View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4417_low_8 (Length: 305)
Name: NF4417_low_8
Description: NF4417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4417_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 11 - 287
Target Start/End: Complemental strand, 18491867 - 18491591
Alignment:
| Q |
11 |
catcatcatctagagtcagtgtggcaaccatagttcataagaacgtcattttttgaactggttgttcctctttcacctcacaatcgatgctcgaaactcc |
110 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18491867 |
catcatcatctagagttagtgtggcaaccatagttcataagaacgtcattttttgaactggttgttcctctttcacctgacaatcgatgctcgaaactcc |
18491768 |
T |
|
| Q |
111 |
attgaaaggtggaagttggggaacattcttgccgcacactgcaacactaacacggactacttggagattggaattagaataaccgatgttagtctcgcca |
210 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
18491767 |
attgaaaggtggaagttggggagcattcttgccgcacactgcaacattaacacggactgcttggagattggaattagagtcaccgatgttagtctcgccg |
18491668 |
T |
|
| Q |
211 |
tagaatttggattgaatcctgttttagtagcccatgaagaagattacgttgctctggtttcaatccatggcaatacc |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
18491667 |
tagaatttggattgaatcctgttttagtagcccatgaagaagattgcgttgctctggtttcaatccatggcaatacc |
18491591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University