View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4419-Insertion-13 (Length: 259)
Name: NF4419-Insertion-13
Description: NF4419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4419-Insertion-13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 102 - 257
Target Start/End: Complemental strand, 21181821 - 21181666
Alignment:
| Q |
102 |
tatcagtatgttgcttaatttgcaagccnnnnnnnttataaatcttacttctacaatgatggtcatttcaaattcattttgcatatggtcagtaaattcc |
201 |
Q |
| |
|
||||||| |||||||| ||||||||||| |||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21181821 |
tatcagtgtgttgcttgatttgcaagccaaaaaaattataaatcttacttctacaatcatgctcatttcaaattcattttgcatatggtcagtaaattcc |
21181722 |
T |
 |
| Q |
202 |
ttacacatgtttccatttgttgagctatagatgatattatcgacatagacttgaac |
257 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21181721 |
ttacacatgttttcatttgttgagccatagatgatattatcgacatagacttgaac |
21181666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 252
Target Start/End: Complemental strand, 17434098 - 17434014
Alignment:
| Q |
168 |
ttcaaattcattttgcatatggtcagtaaattccttacacatgtttccatttgttgagctatagatgatattatcgacatagact |
252 |
Q |
| |
|
||||||||| ||||||| | |||| | ||||||||||| ||| ||| |||||||| ||| | ||||||||| ||| ||||||||| |
|
|
| T |
17434098 |
ttcaaattcgttttgcacagggtctgaaaattccttacgcatattttcatttgttcagccaaagatgatatcatcaacatagact |
17434014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University