View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4419-Insertion-7 (Length: 393)
Name: NF4419-Insertion-7
Description: NF4419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4419-Insertion-7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 3e-45; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 184 - 292
Target Start/End: Complemental strand, 14184602 - 14184494
Alignment:
| Q |
184 |
attattcgttttacccatgattgaaccgtgggtaagtttgatatattatggcctcaataaacctttgaaggaacctacatttttgcatcaaaataaaaga |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |||| |
|
|
| T |
14184602 |
attattcgttttacccatgattgaaccgtgggtaagtttgatatattatggcctcaataaaccttcgaaggaaccaacatttttgcatcaaaatgaaagg |
14184503 |
T |
|
| Q |
284 |
gggaaaccg |
292 |
Q |
| |
|
||||||||| |
|
|
| T |
14184502 |
gggaaaccg |
14184494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 40 - 142
Target Start/End: Complemental strand, 14194955 - 14194851
Alignment:
| Q |
40 |
ttcattgaaagaagaccggtacaaaaagaggaaacattacaacaacatgatcgatc--acattggtttgtgaacaaaataaaatagtgaaaataaataaa |
137 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14194955 |
ttcattgaaggaagaccggtacaaaaagaggaaacattacagcaacatgatcgatctcacattggtttgtgaacaaaataaaatagtgaaaataaataaa |
14194856 |
T |
|
| Q |
138 |
ttata |
142 |
Q |
| |
|
||||| |
|
|
| T |
14194855 |
ttata |
14194851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 319 - 391
Target Start/End: Complemental strand, 14184468 - 14184396
Alignment:
| Q |
319 |
cttgaagacttctttctgtcttgttgggatattcgggagagcttcactaagatcaatcatcagattttgttaa |
391 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14184468 |
cttgaagacttctttctgtcttgttgggacattcgggagagcatcactaagatcaatcatcagattttgttaa |
14184396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 134 - 182
Target Start/End: Complemental strand, 14194422 - 14194374
Alignment:
| Q |
134 |
taaattatattttggagttactcacaatgttgttgtgggaaataaaagt |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14194422 |
taaattatattttggagttactcacaatgttgtcgtgggaaataaaagt |
14194374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 40
Target Start/End: Complemental strand, 14195002 - 14194970
Alignment:
| Q |
8 |
gattcatagatatggtttcttctcatgagatat |
40 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
14195002 |
gattcatagatatggtttcttctcatgagatat |
14194970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University