View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4419_high_30 (Length: 239)
Name: NF4419_high_30
Description: NF4419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4419_high_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 19 - 227
Target Start/End: Complemental strand, 16901236 - 16901048
Alignment:
| Q |
19 |
agggttgcatggtggcattttaattaccttgaaatattagtatgtgattaatcaatgaagggaatttttagaattggacaaaccctaccataggttccat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16901236 |
agggttgcatggtggcattttaattaccttgaaatattagtatgtgattaatcaatgaagggaatttttagaattggacaaaccctaccataggttccat |
16901137 |
T |
|
| Q |
119 |
tctttttcttagnnnnnnncttttcaataatagaaaaagattgtgatcatcaaaatcaatgttgaacttatactaagctactctacattatagagtctaa |
218 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16901136 |
tctttttcttagataaatt-ttttcaataatagaaaaagattg-------------------tgaacttatactaagctactctacattatagagtctaa |
16901057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University