View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4419_low_32 (Length: 253)
Name: NF4419_low_32
Description: NF4419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4419_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 18 - 97
Target Start/End: Complemental strand, 48651940 - 48651861
Alignment:
| Q |
18 |
caagtggtgcatggacgttgttgttttcttcagatcaggattgtggcttccttactcattagggatgttgtgtattatct |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48651940 |
caagtggtgcatggacgttgttgttttcttcagatcaggattgtggcttccttactcattagggatgttgtgtattatct |
48651861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 143 - 253
Target Start/End: Complemental strand, 48651863 - 48651753
Alignment:
| Q |
143 |
tctcaaaaactcaaaatacctaaacttttttgttactttcttcaattgaaacgcaacnnnnnnnctgtttattcaatcacatccgatggtatgttacttt |
242 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48651863 |
tctcaaaaagtcaaaatacctaaacttctttgttactttcttcaattgaaacgcaacaaaaaaactgtttattcaatcacatccgctggtatgttacttt |
48651764 |
T |
|
| Q |
243 |
gatttgtgaat |
253 |
Q |
| |
|
||||||||||| |
|
|
| T |
48651763 |
gatttgtgaat |
48651753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University