View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4420_low_4 (Length: 235)
Name: NF4420_low_4
Description: NF4420
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4420_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 123 - 221
Target Start/End: Complemental strand, 28825697 - 28825599
Alignment:
| Q |
123 |
caagaatgagggagagccataaaattttattttaattttatacgaagcaagagccataatacttttactggataataatattgaaacatagttgaaact |
221 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
28825697 |
caagaaagagggagagccataaaattttattttaattttatacaaagcaagagccttaatacttttattggataaaaatattgaaacatagttgaaact |
28825599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 84 - 121
Target Start/End: Complemental strand, 4614375 - 4614338
Alignment:
| Q |
84 |
cattgattaagaaaacaaatgtagtaaatattacatta |
121 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
4614375 |
cattgattaagaaagcaaatgtagtaagtattacatta |
4614338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 64 - 122
Target Start/End: Complemental strand, 28957832 - 28957774
Alignment:
| Q |
64 |
gttaattgatgtttatggaacattgattaagaaaacaaatgtagtaaatattacattaa |
122 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| || |||| || ||||||||||||||| |
|
|
| T |
28957832 |
gttaatcgatgtttatggaacactgattaaggaattaaatataataaatattacattaa |
28957774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 81 - 121
Target Start/End: Complemental strand, 36974172 - 36974132
Alignment:
| Q |
81 |
gaacattgattaagaaaacaaatgtagtaaatattacatta |
121 |
Q |
| |
|
||||| || |||||||||||||||||||||||||| ||||| |
|
|
| T |
36974172 |
gaacactggttaagaaaacaaatgtagtaaatattgcatta |
36974132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University