View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4421-Insertion-5 (Length: 396)
Name: NF4421-Insertion-5
Description: NF4421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4421-Insertion-5 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 385; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 385; E-Value: 0
Query Start/End: Original strand, 8 - 396
Target Start/End: Original strand, 33161009 - 33161397
Alignment:
| Q |
8 |
gttgcattataaaattcgtttcaaaccctaaattaaccctaaaatgtagttcaatttcactctaatcaattgctttaaacctaaattaaacatcaaatac |
107 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33161009 |
gttgcattatacaattcgtttcaaaccctaaattaaccctaaaatgtagttcaatttcactctaatcaattgctttaaacctaaattaaacatcaaatac |
33161108 |
T |
|
| Q |
108 |
agttccatttcactttaatttatcacttcaaaacctaaattagacattaaacatagttcaatttcactcatcaattcctctgaaacctaaattagaagct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33161109 |
agttccatttcactttaatttatcacttcaaaacctaaattagacattaaacatagttcaatttcactcatcaattcctctgaaacctaaattagaagct |
33161208 |
T |
|
| Q |
208 |
caaattcaatcgaatagaatcatagaacaaaacttgaacactcactttgacatggaaggacctaacagaggattttcagcgagaggctgaaacgagaacc |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33161209 |
caaattcaatcgaatagaatcatagaacaaaacttgaacactcactttgacatggaaggacctaacagaggattttcagcgagaggctgaaacgagaacc |
33161308 |
T |
|
| Q |
308 |
ttccaagagatggaaaagtgcaatcaccgtgagaattggtgaagcaatcgttgacgagcatcgtggcaatgaagaaccctagttggatt |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33161309 |
ttccaagagatggaaaagtgcaatcaccgtgagaattggtgaagcaatcgttgacgagcatcgtggcaatgaagaaccctagttggatt |
33161397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University