View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4421_low_11 (Length: 254)
Name: NF4421_low_11
Description: NF4421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4421_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 75; Significance: 1e-34; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 75 - 180
Target Start/End: Complemental strand, 38428793 - 38428687
Alignment:
| Q |
75 |
aacaccccaatttttgtattgatatattttagtattattatg-taaaatattaccccaagtatgtttgttgtggattgacaatttttaatgtgtttttct |
173 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||||| |||| ||||||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38428793 |
aacaccccaatttttgtattgatatactttaggattattatgctaaattattaccccaaatatgtttgatgtggattgacaatttttaatgtgtttttct |
38428694 |
T |
 |
| Q |
174 |
atatgtg |
180 |
Q |
| |
|
|||||| |
|
|
| T |
38428693 |
ttatgtg |
38428687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 178 - 242
Target Start/End: Original strand, 25487135 - 25487199
Alignment:
| Q |
178 |
gtgctcatattatataatacaaaattttcaggaaaacccacatctctttctgattgcctatgcta |
242 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25487135 |
gtgctcatattatataaatcaaaattttcaggaaaacccacatctctttctgattccctatgcta |
25487199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 178 - 242
Target Start/End: Complemental strand, 25433629 - 25433565
Alignment:
| Q |
178 |
gtgctcatattatataatacaaaattttcaggaaaacccacatctctttctgattgcctatgcta |
242 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||| | || ||||||||||| |||| |||| |
|
|
| T |
25433629 |
gtgctcatattatatcatacaaatttttcaggaaaaccaatatgtctttctgattccctacgcta |
25433565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University