View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4421_low_14 (Length: 215)
Name: NF4421_low_14
Description: NF4421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4421_low_14 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 47991540 - 47991398
Alignment:
| Q |
1 |
gtatacctcttttgatagatgaac--acattgtcatgttccttaaacttcaattccattcctagaaaaagaatcagagtgtgtcgactaccaaatacttg |
98 |
Q |
| |
|
|||||| ||||||||||| ||||| ||| ||||||||| ||||| ||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
47991540 |
gtatacttcttttgatagttgaacccacaatgtcatgttacttaa-cttaaattccattcctagaaaaagaatcagagtgtgtcgacttccaaatacttg |
47991442 |
T |
 |
| Q |
99 |
catcgattcagctt--aacctatttattatccctctctccattt |
140 |
Q |
| |
|
|| | ||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
47991441 |
caacaattcagctttgaacctatttattatccctctcttcattt |
47991398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 215
Target Start/End: Original strand, 35106635 - 35106676
Alignment:
| Q |
174 |
attgactgcaagttaacaatctactactctcaacttctagag |
215 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||| |||| |
|
|
| T |
35106635 |
attgactgcaagttaaaaatctactacgctcaacttccagag |
35106676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University