View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4422_low_9 (Length: 368)
Name: NF4422_low_9
Description: NF4422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4422_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 1 - 353
Target Start/End: Original strand, 30402772 - 30403124
Alignment:
| Q |
1 |
catgaatttcatagaacatgcatagacaaatggttgaaggagattcagaggtatgagaaaatacatattcagatttccttcttgtttctatcactagagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30402772 |
catgaatttcatagaacatgcatagacaaatggttgaaggagattcacaggtatgagaaaatagatatccagatttccttcttgtttctatcactagagt |
30402871 |
T |
 |
| Q |
101 |
tacacatttgcaccatttccctccaatacagaagatctgaaacatatccatattacctgtacatacgatatgaggaaccagagatgcacgcgcatctgca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
30402872 |
tacacatttgcaccatttccctccaatacagaagatctgaaacatatccatattacctgtacatatgatacgaggaaccagagatgcacgcgcatctgca |
30402971 |
T |
 |
| Q |
201 |
taaaataacttcaaaagcaaaaaatttatagcttacatattttcaatcatgggacaccaacccccttttctaacttggcaacatatttatcttgtatctc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30402972 |
taaaataacttcaaaagcaaaaaatttatagcgtacatattttcaatcatgggacacctacccccttttctaacttggcaacatatttatcttgtatctc |
30403071 |
T |
 |
| Q |
301 |
tagctcttcaaatgttttcttatttattagcacaggatttaagattaagtatg |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30403072 |
tagctcttcaaatgttttcttatttattagcacagggtttaagattaagtatg |
30403124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University