View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4423-Insertion-5 (Length: 349)
Name: NF4423-Insertion-5
Description: NF4423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4423-Insertion-5 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 8 - 349
Target Start/End: Original strand, 43953902 - 43954243
Alignment:
| Q |
8 |
aacaggagtgtcattctcactggagacgactccaccaacaaaatgattcatacccaaatccttttcttctgccgatgcatcattatctgcttctagaatc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43953902 |
aacaggagtgtcattctcactggagacgactccaccaacaaaatgattcctacccaaatccttttcttctgccgatgcatcattatctgcttctagaatc |
43954001 |
T |
 |
| Q |
108 |
ccctcattatgtacatccagattatcaacttcctcttcacttcggtattctcactagatgtcgttttattactatctttgagcatcggtggaataataaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43954002 |
ccctcattatgtacatccagattatcaacttcctcttcacttcaatattctcactagatgtcgttttattactatctttgagcatcggtggaataataaa |
43954101 |
T |
 |
| Q |
208 |
ttcatcctcttccgccccttccacttcagcatttatgttcattgttgtaatttgcaatcctggaattttgtccttaagaaaatataatacacttttaatg |
307 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43954102 |
ttcatcctcttccgcaccttccacttcagcatttatgttcattgttgtaatttgcaatcctggaattttgtccttaagaaaatataatacacttttaatg |
43954201 |
T |
 |
| Q |
308 |
ccttgtttagttgcttcctcaatagaacttttcacctcgtca |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43954202 |
ccttgtttagttgcttcctcaatagaacttttcacctcgtca |
43954243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University