View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4423-Insertion-7 (Length: 161)
Name: NF4423-Insertion-7
Description: NF4423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4423-Insertion-7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 8 - 93
Target Start/End: Complemental strand, 49117690 - 49117605
Alignment:
| Q |
8 |
aaactgagtatcctccgcgtgcaattgcggagattaatcattcgaattttacgggactttaatggacgacaaactctttcaaagag |
93 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||| ||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
49117690 |
aaactgagtatcatccacgtgcaattgcggagattaatccttcaaattttatgggactttaatggacgacaaactctttcaaagag |
49117605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 114 - 143
Target Start/End: Complemental strand, 49117581 - 49117552
Alignment:
| Q |
114 |
aaatatgtaattgtgcctaaattttgtgac |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
49117581 |
aaatatgtaattgtgcctaaattttgtgac |
49117552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University