View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4423_high_7 (Length: 339)
Name: NF4423_high_7
Description: NF4423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4423_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 10 - 233
Target Start/End: Original strand, 6450591 - 6450814
Alignment:
| Q |
10 |
agatgaattgaggtgagagacacacaagacatggaatatttgaacacggagagggaatattggattgcaacattacataattagacaaatgctagggttt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6450591 |
agatgaattgaggtgagagacacacaagacatggaatatttgaacacggagagggaatattggattgcaacattacataattagacaaatgctagggttt |
6450690 |
T |
 |
| Q |
110 |
caatttttaaatgttaacgttggaagcagacgattgtttggaatcatttctaaaattcctacttgcacttccttccatgctttgtcttcactcttaagta |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6450691 |
caatttttaaatgttaacgttggaagcagacgattgtttggaatcatttctaaaattcctacttgcacttccttccatgctttgtcttgactcttaagta |
6450790 |
T |
 |
| Q |
210 |
ttgcatgtacaactcttaatagaa |
233 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
6450791 |
ttgcatgtacaactcttaatagaa |
6450814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 266 - 322
Target Start/End: Original strand, 6450841 - 6450894
Alignment:
| Q |
266 |
caattgtaattccgtattattcatagtgaatgaattgaggtaatttatagtattatt |
322 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||| |||||||||||||| |
|
|
| T |
6450841 |
caattgtaattccgtattattgatagttaatgaattgagg---tttatagtattatt |
6450894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University