View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4423_low_14 (Length: 249)
Name: NF4423_low_14
Description: NF4423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4423_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 31523473 - 31523367
Alignment:
| Q |
1 |
caaaattttcttcttgaatgtttgaagcgattcaagttaatttgttatgttctcttcatactact--------agaactagaaggaaactgataagacat |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
31523473 |
caaaattttcttcttgaatgtttgaagcgattcaagttaatttgttatgttctcttcatactactagaagtctagaactagaaggaaactgttaagacat |
31523374 |
T |
 |
| Q |
93 |
tgtttta |
99 |
Q |
| |
|
||||||| |
|
|
| T |
31523373 |
tgtttta |
31523367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 169 - 198
Target Start/End: Original strand, 40976157 - 40976186
Alignment:
| Q |
169 |
tgtttaaatcaatcttgattcgtcaatttg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40976157 |
tgtttaaatcaatcttgattcgtcaatttg |
40976186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University