View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4424_high_20 (Length: 240)
Name: NF4424_high_20
Description: NF4424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4424_high_20 |
 | |
|
| [»] scaffold0187 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0187 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 1891 - 2111
Alignment:
| Q |
1 |
cctctgcccgttcaaccctgcccactttcaaagtacccgagtcatagtcaacacaatgattaattatgaagtttggccaattgtacctacgcctctaatg |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1891 |
cctctgccccttcaaccctgcccactttcaaagtacctgagtcatagtcaacacaatgattaattatgaagtttggccatttgtacctacgcctctaatg |
1990 |
T |
|
| Q |
101 |
tcaaagggatcattgtggtttttctattatgcaatgtttagggttacaaactacaaattgtgattcaatactactatccatattacaagtttacccttga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1991 |
tcaaagggatcattgtggtttttctattatgcaatgtttagggttacaaactacaaattgtgattcaatactactatccatattacaagtttacccttga |
2090 |
T |
|
| Q |
201 |
aacgtagtgcatggtgtcgcc |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
2091 |
aacgtagtgcatggtgtcgcc |
2111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 120 - 196
Target Start/End: Original strand, 4012198 - 4012275
Alignment:
| Q |
120 |
ttttctattatgcaatgtttagggttacaaactacaaa-ttgtgattcaatactactatccatattacaagtttaccc |
196 |
Q |
| |
|
|||||||||||||| || ||| ||||||||| |||||| |||||||| ||| |||| |||||||||||||||||||| |
|
|
| T |
4012198 |
ttttctattatgcattgcttaaggttacaaagtacaaagttgtgattaaatgctacattccatattacaagtttaccc |
4012275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 120 - 196
Target Start/End: Complemental strand, 13976998 - 13976921
Alignment:
| Q |
120 |
ttttctattatgcaatgtttagggttacaaactacaaa-ttgtgattcaatactactatccatattacaagtttaccc |
196 |
Q |
| |
|
|||||||||||||| || ||| ||||||||| |||||| |||||||| ||| |||| |||||||||||||||||||| |
|
|
| T |
13976998 |
ttttctattatgcattgcttaaggttacaaagtacaaagttgtgattaaatgctacattccatattacaagtttaccc |
13976921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 120 - 164
Target Start/End: Complemental strand, 37864998 - 37864954
Alignment:
| Q |
120 |
ttttctattatgcaatgtttagggttacaaactacaaattgtgat |
164 |
Q |
| |
|
|||||||||||| |||||||||| ||||||| || |||||||||| |
|
|
| T |
37864998 |
ttttctattatgtaatgtttaggattacaaaatataaattgtgat |
37864954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University