View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4424_high_22 (Length: 235)
Name: NF4424_high_22
Description: NF4424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4424_high_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 18 - 217
Target Start/End: Complemental strand, 2950799 - 2950600
Alignment:
| Q |
18 |
catcactaatttctatcgataattcatctttttctaattataaaaacattggcgagtcacaaggcgaaaatttaacaaaattaagattgttgttccaata |
117 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||| | ||||||| ||| ||| |||||||| | ||||| ||||||||| ||||||||||||| |
|
|
| T |
2950799 |
catcactaatttttatcgataattcaactttttctaattattagaacattgacgaatcagaaggcgaagaattaactaaattaagaatgttgttccaata |
2950700 |
T |
 |
| Q |
118 |
gttcttgttatcttcattaaaatcactcccaccgccgctaccacttccatcacaagtattacactctccaccgctctccggtgacaaacttaggtcaccg |
217 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
2950699 |
gttcttgttatcttcattgaaatcacttccaccgccgctaccacttccatcacaagtattacattctccaccgctctccggtgacaagctcaggtcaccg |
2950600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University