View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4424_high_24 (Length: 233)
Name: NF4424_high_24
Description: NF4424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4424_high_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 29728987 - 29729209
Alignment:
| Q |
1 |
tatttaaaaagaagacaccactaaagtgataatattaagtatcaccaggaaatgaccaaaatgtcacccaacttacataaagattctttttgtttatttg |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29728987 |
tatttaaaaagaagacactactaaagtgataatattaagtatcaccaggaaatgaccaaaatgtcacccaacttacataaagattctttttgtttatttg |
29729086 |
T |
|
| Q |
101 |
accaaaatactagtacttttagaagagataacaattgcattaagggaagagttaggagaattttgaataaattttaaagttttttctatctctttataat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29729087 |
accaaaatactagtacttttagaagagataacaattgcattaagggaagagttaggagaattttgaataaattttaaagttttttctatctctttataat |
29729186 |
T |
|
| Q |
201 |
attctcaaatccaagaaaatatt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
29729187 |
attctcaaatccaagaaaatatt |
29729209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University