View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4424_high_9 (Length: 341)
Name: NF4424_high_9
Description: NF4424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4424_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 17 - 321
Target Start/End: Original strand, 12550203 - 12550507
Alignment:
| Q |
17 |
cataggaggaaacactgtgttggcgtctgagaaatctgaatgaaaaaggtgtgattaaggttaaccctacaatgaagacaacattgatggattgggagca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12550203 |
cataggaggaaacactgtgttggcgtctgagaaatctgaatgaaaaaggtgtgattaaggttaaccctacaatgaagacaacattgatggattgggagca |
12550302 |
T |
 |
| Q |
117 |
ggtggagactgcttaatgcttgagagaattatcaatgatgcagaggttggttggtaataacaatgtatccgatgcatgcaaataaaaagaaaatgacaaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12550303 |
ggtggagactgcttaatgcttgagagaattatcaatgatgcagaggttggttggtaataacaatgtattcgatgcatgcaaataaaaagaaaatgacaaa |
12550402 |
T |
 |
| Q |
217 |
agttgtgacaccattgatgagaaaacaagcaactcagaatttctttttaaatctttatttaccaaatctttgaatattaaggttggccataaaaatctat |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12550403 |
agttgtgacaccattgatgagaaaacaagcaactcagaatttctttttaaatctttatttaccaaatctttgaatattaaggttggccataaaaatctat |
12550502 |
T |
 |
| Q |
317 |
accag |
321 |
Q |
| |
|
||||| |
|
|
| T |
12550503 |
accag |
12550507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University