View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4424_low_14 (Length: 306)
Name: NF4424_low_14
Description: NF4424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4424_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 20 - 295
Target Start/End: Complemental strand, 5177811 - 5177537
Alignment:
| Q |
20 |
gtatagaggagtaacaaggtgagtctaacatcacatgcattgcactaatttaattttaatatatgatttatatatgaaaaataaaattggctctgattat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5177811 |
gtatagaggagtaacaaggtgagtctaacatcacatgcattgcactaatttaattt-aatatatgatttatatatgaaaaataaaattggctctgattat |
5177713 |
T |
 |
| Q |
120 |
tatctttgtagcagacaccatcaacatggaagatggcaagctcgaatagggagagttgctggaaataaagatctctatcttggaactttcagtgagtata |
219 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5177712 |
tatctttgtagcagacatcatcaacatggaagatggcaagctcgaatagggagagttgctggaaataaagatctctatcttggaactttcagtgagtata |
5177613 |
T |
 |
| Q |
220 |
ctctcacatttttggttattctttcttttgtgattgtgaccaatatatttgagaaatgatatttttggttattcat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5177612 |
ctctcacatttttggttattctttcttttgtgattgtaaccaatatatttgagaaatgatatttttggttattcat |
5177537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 57; Significance: 8e-24; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 128 - 216
Target Start/End: Original strand, 40190506 - 40190594
Alignment:
| Q |
128 |
tagcagacaccatcaacatggaagatggcaagctcgaatagggagagttgctggaaataaagatctctatcttggaactttcagtgagt |
216 |
Q |
| |
|
||||||||| || ||||||||||||||||||||| |||| || ||||| ||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
40190506 |
tagcagacatcaccaacatggaagatggcaagctagaattggtagagtggctggtaataaagatctatatcttggaactttcagtgagt |
40190594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 141 - 212
Target Start/End: Complemental strand, 24562180 - 24562109
Alignment:
| Q |
141 |
caacatggaagatggcaagctcgaatagggagagttgctggaaataaagatctctatcttggaactttcagt |
212 |
Q |
| |
|
|||||||||||||||||||| | || || |||||||| |||||||||||||| || | |||||||||||| |
|
|
| T |
24562180 |
caacatggaagatggcaagcaaggattggcagagttgcaggaaataaagatctatacttgggaactttcagt |
24562109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 130 - 212
Target Start/End: Complemental strand, 30618771 - 30618689
Alignment:
| Q |
130 |
gcagacaccatcaacatggaagatggcaagctcgaatagggagagttgctggaaataaagatctctatcttggaactttcagt |
212 |
Q |
| |
|
||||||| ||||||||||| |||||||||||| | || || |||||||| || || ||||||||||| || |||||||||||| |
|
|
| T |
30618771 |
gcagacatcatcaacatggtagatggcaagctaggattggaagagttgcaggcaacaaagatctctacctaggaactttcagt |
30618689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University