View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4424_low_20 (Length: 254)
Name: NF4424_low_20
Description: NF4424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4424_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 7 - 240
Target Start/End: Complemental strand, 6475913 - 6475679
Alignment:
| Q |
7 |
tctcttttatagatcttaagaaagtttttgacataaaactcatggatcctt-gcagcccatttcagaagcttgagttgaaagccacaaatgatggaagat |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6475913 |
tctcttttatagatcttaagaaagtttttgacataaaactcatggatcctttgcagcccatttcagaagcttgagttgaaagccacaaatgatggaagat |
6475814 |
T |
|
| Q |
106 |
caggtttctctttttcatcatatgagctacaatagattgtgtgacacataggatatcaaaatccatcatttgatccttgaggtggtttacagttagtcaa |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6475813 |
caggtttctctttttcatcatatgagctacaatagattgtgtgacacatagcatatcaaaatccatcatttgatccttgaggtggtttacagttagtcaa |
6475714 |
T |
|
| Q |
206 |
gaacctggaagattatgcaagagctcatgactgtc |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
6475713 |
gaacctggaagattatgcaagagctcatgactgtc |
6475679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University