View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4424_low_22 (Length: 247)
Name: NF4424_low_22
Description: NF4424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4424_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 164
Target Start/End: Original strand, 39300011 - 39300174
Alignment:
| Q |
1 |
cgatccctctcactctgtttcacattttgatcagagtgagactgaaaaccttgtttgtgtccaaggttggtagcagcagcatgatgatgatccctatcac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39300011 |
cgatccctctcactctgtttcacattttgatcagagtgagactgaaaaccttgcttgtgaccaaggttcgtagcagcagcatgatgatgatccctatcac |
39300110 |
T |
 |
| Q |
101 |
tctgcttcacatttgaaccaagttcatgagtctctcttgatcttcctcttccaccaatatctcc |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39300111 |
tctgcttcacatttgaaccaagttcatgagtctctcttgatcttcctcttccaccaatatctcc |
39300174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 112 - 234
Target Start/End: Original strand, 39299888 - 39300010
Alignment:
| Q |
112 |
tttgaaccaagttcatgagtctctcttgatcttcctcttccaccaatatctcccaaaccttcacctctttctttcatgccttctgcaccttgtctgtgtc |
211 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39299888 |
tttgaaccaagttcatggctctctctttctcttcctcttccaccaatatctcccaaaccttcacctctttctttcatgccttctgcaccttgtctgtgtc |
39299987 |
T |
 |
| Q |
212 |
caactacatttgtagcatgatga |
234 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
39299988 |
caactacatttgtagcatgatga |
39300010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University