View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4424_low_8 (Length: 395)
Name: NF4424_low_8
Description: NF4424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4424_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 1 - 377
Target Start/End: Complemental strand, 29987211 - 29986835
Alignment:
| Q |
1 |
gaaacgtgttgacgacaacgtgtcggtgacgaatccaaannnnnnnnnnnnagtttaaattaaaaattttggatactctttaaatatgtatcgacaatgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
29987211 |
gaaacgtgttgacgacaacgtgtcggtgacgaatccaaatttttattttttagtttaaattaaaaaatttggacactctttaaatatgtatcgacaatgt |
29987112 |
T |
 |
| Q |
101 |
atcagaacatatcaggtgtgattcaacggccatatttgcatgcttcatagggcagaatcaaaaagggagatttataatacctgacaccgacgaatttacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29987111 |
atcagaacatatcaggtgtgattcaacggccatatttgcatgcttcatagggcagaatcaaaaagggagatttataatacctgacaccgacgaatttacc |
29987012 |
T |
 |
| Q |
201 |
cctgacactgatgagtttctcattgaatgttgttttggaatgtacaaggttgttaccaaatttaacagttcttgaattggattctaggtttttattgtat |
300 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29987011 |
cctgatactgacgagtttctcattgaatgttgttttggaatgtacaaggttgttaccaaatttaacagttcttgaattggattctaggtttttattgtat |
29986912 |
T |
 |
| Q |
301 |
taatctcatatctagaattttttgagtttgtcaaatgtagatttgatgtggtgttgtaatttggttaatgtagattt |
377 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29986911 |
taatctcatatctagaattttttgagtttgtcaaatgtagatttgatgtggtgttgtaatttggttaatgtagattt |
29986835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University