View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4426-Insertion-10 (Length: 137)
Name: NF4426-Insertion-10
Description: NF4426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4426-Insertion-10 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 6e-66; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 6e-66
Query Start/End: Original strand, 7 - 137
Target Start/End: Complemental strand, 3106962 - 3106832
Alignment:
| Q |
7 |
aagttaaacctatctcacgagcagagcagattggtaaatatatatgggcatcgagcttggagttccccaagaaagaagcaaccaactttgtcccttttct |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3106962 |
aagttaaacctatctcacgagcagagcagattggtaaatatatatgggcatcgagcttggagttccccaagaaagaagcaaccaactttgtcacttttct |
3106863 |
T |
|
| Q |
107 |
cattttgcattgatattcacgtttttgtttc |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3106862 |
cattttgcattgatattcacgtttttgtttc |
3106832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University