View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4426-Insertion-6 (Length: 438)
Name: NF4426-Insertion-6
Description: NF4426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4426-Insertion-6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-137; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 8 - 283
Target Start/End: Original strand, 16305751 - 16306026
Alignment:
| Q |
8 |
caacaacaggtaaaaccattgtagcaaatatctcaataggtcaaccccctatcccacaattactcatcgcagacaccgctagtaacaaggtcatattttc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
16305751 |
caacaacaggtaaaaccattgtagcaaatatctcaataggtcaaccccctatcccacaatcactcatcgcagacaccggtagtaacaaggtcatattttc |
16305850 |
T |
|
| Q |
108 |
gatccttaaaagtcgccaacctattcaccatcatgcaagtaaccctgttagttcaacgactgtgtgaatgtggcctcaccgatcggctgacaattgacat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
16305851 |
gatccttaaaagtcgccaacctattcaccatcatgcaaataaccctgttagttcaacgactgtgtgaatgcggcctcaccgatcggctgacaattgacat |
16305950 |
T |
|
| Q |
208 |
acaacaccacttatgtagacaattcatcctcatcaggaacacttggcatggacatgctggtctttgagacatgtga |
283 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16305951 |
acaacaccacttacgcagacaattcatcctcatcaggaacacttggcttggacatgctggtctttgagacatgtga |
16306026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 357 - 438
Target Start/End: Original strand, 16306067 - 16306148
Alignment:
| Q |
357 |
tacaatggaatactagggttaggactaaacaggtaaaaaatgttcttactgcataggtagcttaactgacaagtcaaaaatt |
438 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16306067 |
tacaatggaatactagggttaggactaaacaggtaaaaaatgttcttactgcataggtagcttaactgacaagtcaaaaatt |
16306148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 370 - 405
Target Start/End: Original strand, 16306033 - 16306069
Alignment:
| Q |
370 |
tagggttaggactaaacaggt-aaaaaatgttcttac |
405 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
16306033 |
tagggttaggactaaacaggtaaaaaaatgttcttac |
16306069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University