View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4426-Insertion-9 (Length: 149)
Name: NF4426-Insertion-9
Description: NF4426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4426-Insertion-9 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 2e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 2e-75
Query Start/End: Original strand, 7 - 149
Target Start/End: Complemental strand, 521466 - 521324
Alignment:
| Q |
7 |
agtagtttcatcagagaaagatgaagagtttacaatcatgacatgctcaatcatgggaaggtcttgttcagagcaggtatagaatcgactgctgaaaagt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
521466 |
agtagtttcatcagagaaagatgaagagtttacaatcatgacatgctcaatcatgggaaggtcttgttcagagcaggtatagaatcgactgctgaaaagt |
521367 |
T |
|
| Q |
107 |
gatgaatttacacaaatttcagagatccatctcgcgctttgtg |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
521366 |
gatgaatttacacaaatttcagagatccatctcgcgctttgtg |
521324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University