View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4426_high_15 (Length: 362)
Name: NF4426_high_15
Description: NF4426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4426_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 19 - 356
Target Start/End: Original strand, 32572536 - 32572873
Alignment:
| Q |
19 |
cttctgggcttaaagccgggattgaacgtgtcgccaagggtaaacacacaccaatcacactagttgctaagattgagaatatggctatgagttttagagg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32572536 |
cttctgggcttaaagccgggattgaacgtgtcgccaagggtaaacacacaccaatcacactagttgctaagattgagaatatggctatgagttttagagg |
32572635 |
T |
 |
| Q |
119 |
ctgagctttttctttgttgttgcaactgtttgtggattcactttcacaatcagctagggcttgtgatgttaagaaagtgattaagatgaaaacaatgaag |
218 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32572636 |
ctgagccttttctttgttgttgcaactgtttgtggattcactttcacaatcagctagggcttgtgatgttaaaaaagtgattaagatgaaaacaatgaag |
32572735 |
T |
 |
| Q |
219 |
attgctttgtgtacagttactgaataagtcattatttgaggttttctagcctgtaattatgctaactgagctatcttgtgttggttttgattgagtaatt |
318 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32572736 |
attgctttgtgtatagttactgaataagccattatttgatgttttctagcctgtaattatgctaactgagctatcttgtgttggttttgattgagtaatt |
32572835 |
T |
 |
| Q |
319 |
aatcttcattataatttatatatatagacctttgctac |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32572836 |
aatcttcattataatttatatatatagacctttgctac |
32572873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University