View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4426_high_16 (Length: 358)
Name: NF4426_high_16
Description: NF4426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4426_high_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 20 - 343
Target Start/End: Original strand, 38900108 - 38900431
Alignment:
| Q |
20 |
gtcctttgtggagtttttctgcgaggctttgcatcactatattgcagtttcagattcacttgttagtactctgtcgcgtagccataagatggagttagcc |
119 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38900108 |
gtcctttgtggagtttttctgtgaggctttgcatcactatattgcagtttcagattcacttgttagtactctgtcgcgtagccataagatggagttagcc |
38900207 |
T |
|
| Q |
120 |
cttatagagaaagaggttttggggaatagaatcttagacagtgtaagacagtttccttgtgaaaaagaggagagaatattgtgggaagaaagannnnnnn |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38900208 |
cttatagagaaagaggttttggggaatagaatcttagacagtgtaagacagtttccttgtgaaaaagaggagagaatattgtgggaaggaagattttttt |
38900307 |
T |
|
| Q |
220 |
attcattgaaagggtataaacgtgttggaatgagtacatgtaatatttcacaggctaagttattggttagcttgtttggtaaagggtattgggtgcaatt |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38900308 |
attcattgaaagggtataaacgtgttggaatgagtacatgtaatatttcacaggctaagttattggttagcttgtttggtaaagggtattgggtgcaatt |
38900407 |
T |
|
| Q |
320 |
tgagaactgtaagttggctctgtg |
343 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
38900408 |
tgagaactgtaagttggctctgtg |
38900431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University