View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4426_high_32 (Length: 289)
Name: NF4426_high_32
Description: NF4426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4426_high_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 18 - 55
Target Start/End: Complemental strand, 5018089 - 5018052
Alignment:
| Q |
18 |
attgatgcattatatatatgatatagtaaatttaactt |
55 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5018089 |
attgttgcattatatatatgatatagtaaatttaactt |
5018052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 42663754 - 42663791
Alignment:
| Q |
18 |
attgatgcattatatatatgatatagtaaatttaactt |
55 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42663754 |
attgttgcattatatatatgatatagtaaatttaactt |
42663791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 9814418 - 9814455
Alignment:
| Q |
18 |
attgatgcattatatatatgatatagtaaatttaactt |
55 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
9814418 |
attgttgcattatatatatgatgtagtaaatttaactt |
9814455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 23165807 - 23165844
Alignment:
| Q |
18 |
attgatgcattatatatatgatatagtaaatttaactt |
55 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
23165807 |
attgctgcattatatatatgatatagtaaacttaactt |
23165844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University