View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4426_high_37 (Length: 255)
Name: NF4426_high_37
Description: NF4426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4426_high_37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 23975841 - 23975601
Alignment:
| Q |
1 |
ccaacttcgtaaggagaggcagccatgtagtatgagcctataggttggtttgctgtgaacaaagcatcaaccgtttggccaggggcgataacgatgacgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| || |
|
|
| T |
23975841 |
ccaacttcgtaaggagaggcagccatgtagtaagatcctataggttgatttgctgtgaacaaagcatcaactgtttggccaggggcgataacgatgatgt |
23975742 |
T |
|
| Q |
101 |
cggtcttgaatggatcggtgtagtcagcatctagtgcaacaactgtgaaattgtgatttgctattttgaagaaaagatgattattgagtgcaacattgat |
200 |
Q |
| |
|
| |||| |||||||| |||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
23975741 |
cagtctcgaatggattcgtgtagtcagcatccagtgcaacaactgtgaaactgtgatttgctattttgaagaaaagattgttattgagtgcaacattgat |
23975642 |
T |
|
| Q |
201 |
tattcgtagtaagtatgtcatccctggtttcaccttcatct |
241 |
Q |
| |
|
||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
23975641 |
tatccgtagcaagtatgtcatccctggtttcaccttcatct |
23975601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 139 - 215
Target Start/End: Complemental strand, 6026172 - 6026096
Alignment:
| Q |
139 |
acaactgtgaaattgtgatttgctattttgaagaaaagatgattattgagtgcaacattgattattcgtagtaagta |
215 |
Q |
| |
|
|||||||||||| | || |||||||| ||||||||| | || | |||||||||| ||||||| || ||||||||||| |
|
|
| T |
6026172 |
acaactgtgaaactatggtttgctatcttgaagaaatgttgttcattgagtgcagcattgataatgcgtagtaagta |
6026096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University