View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4426_high_41 (Length: 250)
Name: NF4426_high_41
Description: NF4426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4426_high_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 44144958 - 44144712
Alignment:
| Q |
1 |
ttattatgtctctaatgaaaatcttgttttcatgtcaaaaagaataaaataatcctcctattcgaagcttgcaagtgagtctaaatttgatggcattttt |
100 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||||| | |||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
44144958 |
ttattatttctctaatgaaaatcttattttcatgtcaaaaaaattaaaataatcctcctattcgaaacttgcaagtgagtctaaatttgattgcattttt |
44144859 |
T |
 |
| Q |
101 |
tgactataaaacacctgatattatagttgtttatttacga----ttattgttttatagaaacatgtctaagatagtatgctttctaagaataccatgtca |
196 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||| || || |||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44144858 |
tgacaataaaacacctgatattatatttgtttatttacgattttttttttttttattgaaacatgtctaagatagtatgctttctaagaataccatgtca |
44144759 |
T |
 |
| Q |
197 |
gcattgttttttaattttactaatcaacaataggttcagtattatct |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
44144758 |
gcattgttttttaattttactaatcaacaatagattcagtattatct |
44144712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University