View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4426_high_45 (Length: 245)
Name: NF4426_high_45
Description: NF4426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4426_high_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 11 - 228
Target Start/End: Complemental strand, 52287184 - 52286967
Alignment:
| Q |
11 |
cacagaagatcattctctgttggaatcaaacttctttcaggaaacaagtcatcatcaaattcttcgatatctggttcatcgtcattttcactttcaaaca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52287184 |
cacagaagatcattctctgttggaatcaaacttctttcaggaaacaagtcatcatcaaattcttcgatatctggttcatcgtcattttcactttcaaaca |
52287085 |
T |
 |
| Q |
111 |
aatcatatggatgtcatcaaactcaccagcttctcaaaaggtgcagcagtgcaagttcagagatagaaaactcaatccaaggagcaattgcacactgcaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52287084 |
aatcatatggatgtcatcaaactcaccagcttctcaaaaggtgcagcagtgcaagttcagagatagaaaactcaatccaaggagcaattgcacactgcaa |
52286985 |
T |
 |
| Q |
211 |
gaagtctcagcaaatgtt |
228 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
52286984 |
gaagtctcagcaaatgtt |
52286967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University