View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4426_high_49 (Length: 242)
Name: NF4426_high_49
Description: NF4426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4426_high_49 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 6639632 - 6639848
Alignment:
| Q |
1 |
cgttggtccatcttcgatcaagtagatttgcgcaaaatctaattttcactattttggatatgnnnnnnncttacaaaataattgaatttccgtgcttacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6639632 |
cgttggtccatcttcgatcaagtagatttgcgcaaaatctaattttcactattttggatatgtttttttcttacaaaataattgaatttccgtgcttacc |
6639731 |
T |
 |
| Q |
101 |
gtcattcccnnnnnnngtactacatattctttatcttt-aagttttaacattcttgaaaagcaaacatgttgaattattttctttatgttcttcaatata |
199 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6639732 |
gtcattccctttttttgtactacatattctttatcttttaagttttaacattcttgaaaagcaaacatgttgaattattttctttatgttcttcaatata |
6639831 |
T |
 |
| Q |
200 |
tattgaagtttgatgtt |
216 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
6639832 |
tattgaagtttgatgtt |
6639848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University