View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4426_low_26 (Length: 321)
Name: NF4426_low_26
Description: NF4426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4426_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 19 - 235
Target Start/End: Original strand, 37437019 - 37437226
Alignment:
| Q |
19 |
ataaaggtctcacgtgcttagctaatttcaaagacatttgttttataaatctgcggttgcttctcttatatatgttccaactggaatcatgaatttttct |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37437019 |
ataaaggtctcacgtgcttagctaatttcaaagacatttgttttataaatctgcggttgcttctcttat----gttccaactggaatcatgaatttttct |
37437114 |
T |
 |
| Q |
119 |
agtttattgttgtttttagtttgcttgttacttactgtcatgtgttcagaaaaagcaaatgataataaacttgtaatgggggatgatgagaatcactcca |
218 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37437115 |
agtt-attgttgtttttagtttgcttgttac----tgtcatgtgttcagaaaaagcaaatgataataaacttgtaatgggggatgatgagaatcactcca |
37437209 |
T |
 |
| Q |
219 |
cgtcttgatggatattg |
235 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
37437210 |
cgtcttgatggatattg |
37437226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 237 - 313
Target Start/End: Original strand, 37437258 - 37437334
Alignment:
| Q |
237 |
tggttatttatttcaatgaagcttaatttgttaccataagtctatacccagaccttgctgaccacaattcctttgct |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37437258 |
tggttatttatttcaatgaagcttaatttgttaccataagtctatacccagaccttgctgaccacaattcctctgct |
37437334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University