View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4426_low_29 (Length: 311)
Name: NF4426_low_29
Description: NF4426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4426_low_29 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 1 - 311
Target Start/End: Original strand, 45791771 - 45792083
Alignment:
| Q |
1 |
agggtcaaaaagcactgcctatttttgggttaacctagcatgaagaaagtaaaatctgacaccttggtgtataatttgttttatgtatacatgttattct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45791771 |
agggtcaaaaagcactgcctatttttgggttaacctagcatgaagaaagtaaaatctgacaccttggtgtataatttgttttatgtatacatgttattct |
45791870 |
T |
 |
| Q |
101 |
tccttctgtgttttacttatctttt--gtcaataggtatttttgaaaactagcctttcacaattcagtttattctttgttgcaggaaatttcaaaattga |
198 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45791871 |
tccttctgtgttttacttattttttttgtcaataggtatttttgaaaactagcctttcacaattcagtttattttttgttgcaggaaatttcaaaattga |
45791970 |
T |
 |
| Q |
199 |
ggtatgagttgtgtccactcgtcatgaaagagaggaagttttggagaatatattttatacttgtgaataatcatgttgcaccgtcagtagtttatactat |
298 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| ||||||||||||||| |
|
|
| T |
45791971 |
ggtatgagttgtgtccacatgtcatgaaagagaggaagttttggagaatatattttatacttgtgaataatcatatcgcaccgtaagtagtttatactat |
45792070 |
T |
 |
| Q |
299 |
tgcttgagtattt |
311 |
Q |
| |
|
||||||||||||| |
|
|
| T |
45792071 |
tgcttgagtattt |
45792083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University