View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4426_low_42 (Length: 255)

Name: NF4426_low_42
Description: NF4426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4426_low_42
NF4426_low_42
[»] chr7 (1 HSPs)
chr7 (1-241)||(23975601-23975841)
[»] chr4 (1 HSPs)
chr4 (139-215)||(6026096-6026172)


Alignment Details
Target: chr7 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 23975841 - 23975601
Alignment:
1 ccaacttcgtaaggagaggcagccatgtagtatgagcctataggttggtttgctgtgaacaaagcatcaaccgtttggccaggggcgataacgatgacgt 100  Q
    |||||||||||||||||||||||||||||||| || ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| ||    
23975841 ccaacttcgtaaggagaggcagccatgtagtaagatcctataggttgatttgctgtgaacaaagcatcaactgtttggccaggggcgataacgatgatgt 23975742  T
101 cggtcttgaatggatcggtgtagtcagcatctagtgcaacaactgtgaaattgtgatttgctattttgaagaaaagatgattattgagtgcaacattgat 200  Q
    | |||| ||||||||  |||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||  ||||||||||||||||||||    
23975741 cagtctcgaatggattcgtgtagtcagcatccagtgcaacaactgtgaaactgtgatttgctattttgaagaaaagattgttattgagtgcaacattgat 23975642  T
201 tattcgtagtaagtatgtcatccctggtttcaccttcatct 241  Q
    ||| ||||| |||||||||||||||||||||||||||||||    
23975641 tatccgtagcaagtatgtcatccctggtttcaccttcatct 23975601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 139 - 215
Target Start/End: Complemental strand, 6026172 - 6026096
Alignment:
139 acaactgtgaaattgtgatttgctattttgaagaaaagatgattattgagtgcaacattgattattcgtagtaagta 215  Q
    |||||||||||| | || |||||||| ||||||||| | || | |||||||||| ||||||| || |||||||||||    
6026172 acaactgtgaaactatggtttgctatcttgaagaaatgttgttcattgagtgcagcattgataatgcgtagtaagta 6026096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University