View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4426_low_44 (Length: 251)
Name: NF4426_low_44
Description: NF4426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4426_low_44 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 25 - 234
Target Start/End: Complemental strand, 36490133 - 36489921
Alignment:
| Q |
25 |
ttttctttacttaaaattctcacagtcctgatgatcgaggaactaataat---tttatttttatctacattggatatttttaattaaatgttcagtccca |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36490133 |
ttttctttacttaaaattctcacagtcctgatgatcgaggaactaataatatttttttttttatctacattggatatttttaattaaatgttcagtccca |
36490034 |
T |
|
| Q |
122 |
taaaactgtagaaaagtgtagcacaaagagaaagaacattgcagatatatcaccttcatattaattatatatctaactatcaaatatgtcacccttgcct |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36490033 |
taaaactgtagaaaagtgtagcacaaagagatagaacattgcagatatatcaccttcatattaattatatatctaactatcaaatatgtcacccttgcct |
36489934 |
T |
|
| Q |
222 |
tttcccgcctatg |
234 |
Q |
| |
|
||||||||||||| |
|
|
| T |
36489933 |
tttcccgcctatg |
36489921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University