View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4427-Insertion-3 (Length: 72)
Name: NF4427-Insertion-3
Description: NF4427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4427-Insertion-3 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 65; Significance: 3e-29; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 3e-29
Query Start/End: Original strand, 8 - 72
Target Start/End: Complemental strand, 44830862 - 44830798
Alignment:
| Q |
8 |
atgacgaaggctgtacaatcggttcagccatcgtcggaacaccaccttcatcattgaccgttgca |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44830862 |
atgacgaaggctgtacaatcggttcagccatcgtcggaacaccaccttcatcattgaccgttgca |
44830798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University