View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4427_high_15 (Length: 333)
Name: NF4427_high_15
Description: NF4427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4427_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 18 - 317
Target Start/End: Original strand, 31009073 - 31009372
Alignment:
| Q |
18 |
ataacatacaaatatttacctcaatttggctccatctgcattttgttgttgcttcttctgcaatcaacaaccaatctccatctgcaggagaagcacacaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| ||||||||| |||||||||||| |
|
|
| T |
31009073 |
ataacatacaaatatttacctcaatttggctccatctgaattttgttgttgcttcttctgcaatcaacaatcaatctacatctgcagaagaagcacacaa |
31009172 |
T |
 |
| Q |
118 |
cacaaaaatggggtatgtagaaacaacctcatcacaactacacacccctcttctttctgaccaaccccctctgtcctcaaaatccaaaacctttgcaaac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31009173 |
cacaaaaatggggtatgtagaaacaacctcatcacaactacacacccctcttctttctgaccaaccccctctgtcctcaaaatccaaaacctttgcaaac |
31009272 |
T |
 |
| Q |
218 |
ctcttcattgcaattgtaggtgcaggtgttcttggtctcccttatactttcacgaaaacaggttggattatggggttgcttatgcttttctctgtttcat |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31009273 |
ctcttcattgcaattgtaggtgcaggtgttcttggtctcccttatactttcacgaaaacaggttggatcatggggttgcttatgcttttctctgtttcat |
31009372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University