View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4427_high_28 (Length: 240)
Name: NF4427_high_28
Description: NF4427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4427_high_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 225
Target Start/End: Original strand, 31352950 - 31353156
Alignment:
| Q |
19 |
caaacactagttgtgaacgtcaatttcctaatcaatatgcacttcaggtcatgtaattgaagatattaacagacatacttctgctccagcctccagttta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31352950 |
caaacactagttgtgaacgtcaatttcctaatcaatatgcccttcaggtcatgtaattgaagatattaacagacatacttctgctttagcctccagttta |
31353049 |
T |
 |
| Q |
119 |
aaccaaccccgcaaaaagctttatgttatgtaccagcaaagatttcattttggggtgttcggttttatgattttgtgggttggggaagaagtttcatatc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31353050 |
aaccaaccccgcaaaaagctttatgttatgtaccagcaaagatttcattttggggtgttcggttttatgattttgtgggttggggaagaagtttcatatc |
31353149 |
T |
 |
| Q |
219 |
tattcat |
225 |
Q |
| |
|
||||||| |
|
|
| T |
31353150 |
tattcat |
31353156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 225
Target Start/End: Original strand, 31363358 - 31363564
Alignment:
| Q |
19 |
caaacactagttgtgaacgtcaatttcctaatcaatatgcacttcaggtcatgtaattgaagatattaacagacatacttctgctccagcctccagttta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31363358 |
caaacactagttgtgaacgtcaatttcctaatcaatatgcccttcaggtcatgtaattgaagatattaacagacatacttctgctttagcctccagttta |
31363457 |
T |
 |
| Q |
119 |
aaccaaccccgcaaaaagctttatgttatgtaccagcaaagatttcattttggggtgttcggttttatgattttgtgggttggggaagaagtttcatatc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31363458 |
aaccaaccccgcaaaaagctttatgttatgtaccagcaaagatttcattttggggtgttcggttttatgattttgtgggttggggaagaagtttcatatc |
31363557 |
T |
 |
| Q |
219 |
tattcat |
225 |
Q |
| |
|
||||||| |
|
|
| T |
31363558 |
tattcat |
31363564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University