View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4427_high_34 (Length: 207)
Name: NF4427_high_34
Description: NF4427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4427_high_34 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 93 - 207
Target Start/End: Original strand, 4363041 - 4363157
Alignment:
| Q |
93 |
gttaacctcatcttgaatttgatcctgaaattgttgatcactgtcctgttaatcctgtgaattttgaaaaattcgaaggatgccagagcttga--tcaca |
190 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4363041 |
gttaacctcatcttgaatttggtcctgaaattgttgatcactatcctgttaatcctgtgaattttgaaaaattcgaaggatgccagagcttgatctcaca |
4363140 |
T |
|
| Q |
191 |
gaagtccaactagagct |
207 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
4363141 |
gaagtccaactagagct |
4363157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University