View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4427_low_19 (Length: 304)
Name: NF4427_low_19
Description: NF4427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4427_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 23 - 294
Target Start/End: Complemental strand, 46340752 - 46340464
Alignment:
| Q |
23 |
gatccccttgtctgacccctctgctacaagaaaagtaaccatgttgtcttccattgaaagagatagatagcttgttgaattaaggatgactcttatccag |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |||| |
|
|
| T |
46340752 |
gatccccttgtctgacccctctgctacaagaaaagtaaccatgttgtcttccattgaaagagatagatagcttgctgaattaaggatgacttttaaccag |
46340653 |
T |
|
| Q |
123 |
ttgcagaattttgagttaaaaccagatgctttcaacactttaacgacgaaactccaattgagagtatcaaatgccttggcagtatcaatctt-------- |
214 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||||||| ||||||| ||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
46340652 |
ttgcagaattttgagttaaaaccaaatgctttcaacaatttaacgaggaaactctaattgagagtatcaagtgccttggcaatatcaatcttcattgcta |
46340553 |
T |
|
| Q |
215 |
---------cataagttgagtaaagaattaatagcttcagatgtaagagaggtgcaatcctttatgcctcttcctttaataaatcctct |
294 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46340552 |
gattccctccataagttgtgtaaagaattaatagcttcagatgtaagacaggtgcaatcctttatgcctcttcctttaataaatcctct |
46340464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University