View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4427_low_26 (Length: 258)
Name: NF4427_low_26
Description: NF4427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4427_low_26 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 4 - 139
Target Start/End: Original strand, 15098112 - 15098248
Alignment:
| Q |
4 |
aagatgaaaacagaagatgaaaagagggtctactttgtttgtttcaatataatcaatcatacataatctacctataatagctagtgaagag-aaaaaggg |
102 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15098112 |
aagatgaaaacagaagatgaaaagaggatctactttgtttgtttcaatataatcaatcatacataatctacctataatagctagtgaagagaaaaaaggg |
15098211 |
T |
|
| Q |
103 |
taagcacaaacataccttttcttcttctaggtctcta |
139 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
15098212 |
taagcacaaacaaaccttttcttcttctaggtttcta |
15098248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 154 - 207
Target Start/End: Original strand, 15098539 - 15098592
Alignment:
| Q |
154 |
atttttaatctcataatttgatggggtgaaagtttaaaaagtaaagaatcttta |
207 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
15098539 |
atttttgatctcataatttgatgggatgaaagtttaaaaagtaaagaatcttta |
15098592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University