View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4427_low_28 (Length: 254)
Name: NF4427_low_28
Description: NF4427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4427_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 15 - 247
Target Start/End: Complemental strand, 37977082 - 37976850
Alignment:
| Q |
15 |
atctataacaatgtgctgcaggagctcattgttcaacatcatttaatgagatacaagacatcataccaatatgattctgtatttgctcttggttttgtca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37977082 |
atctataacaatgtgctgcaggagctcattgttcaacatcatttaatgagatacaagacatcataccaatatgattctgtatttgctcttggttttgtca |
37976983 |
T |
 |
| Q |
115 |
ctgtctatgataaactcatggaagggtattctagtgaagaggagcgagataccatcttcaaagcttatattaatgcattgaaggaagatccagaacaata |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37976982 |
ctgtctatgataaactcatggaagggtattctagtgaagaggagcgtgataccatcttcaaagcttatattaatgcattgaaggaagatccagaacaata |
37976883 |
T |
 |
| Q |
215 |
caggtttcatgatcgactaatttccctttgcta |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
37976882 |
caggtttcatgatcgactaatttccctttgcta |
37976850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 94; Significance: 6e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 27 - 220
Target Start/End: Complemental strand, 15981730 - 15981537
Alignment:
| Q |
27 |
gtgctgcaggagctcattgttcaacatcatttaatgagatacaagacatcataccaatatgattctgtatttgctcttggttttgtcactgtctatgata |
126 |
Q |
| |
|
||||| |||||||||||||| || || ||||| ||||||||||||| ||||||| |||||| |||||||||||||||| ||||||||||| ||||| |
|
|
| T |
15981730 |
gtgctacaggagctcattgtccagcaacatttgatgagatacaagaagtcataccgttatgatcctgtatttgctcttggctttgtcactgtatatgacc |
15981631 |
T |
 |
| Q |
127 |
aactcatggaagggtattctagtgaagaggagcgagataccatcttcaaagcttatattaatgcattgaaggaagatccagaacaatacaggtt |
220 |
Q |
| |
|
||||||||||||||||| ||||||| ||||| ||||| |||||||| |||| || ||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
15981630 |
aactcatggaagggtatcctagtgatgaggacagagatgccatcttccaagcatacattaacgcattgaaggaagatccagcccaatacaggtt |
15981537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University