View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4429-Insertion-15 (Length: 280)
Name: NF4429-Insertion-15
Description: NF4429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4429-Insertion-15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 4e-44; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 182 - 272
Target Start/End: Original strand, 47321319 - 47321409
Alignment:
| Q |
182 |
ttctccaattgttccagcttcttcgatctttctgtgtcagcttcacctgttccaactcttacagctttgaaaagcttcaatatttctaaaa |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47321319 |
ttctccaattgttccagcttcttcgatctttctgtgtcagcttcacctgttccaactcttacagctttgaaaagcttcaatatttctaaaa |
47321409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University