View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4429_high_2 (Length: 324)
Name: NF4429_high_2
Description: NF4429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4429_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 16 - 318
Target Start/End: Complemental strand, 50049111 - 50048809
Alignment:
| Q |
16 |
atgccttctttgcatttgacataatcctgacattctttgtggcttacttggataaatcaacttatttccttgttgatgaccataagaagattgctatcag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50049111 |
atgccttctttgcatttgacataatcctgacattctttgtggcttacttggataaatcaacttatttccttgttgatgaccataagaagattgctatcag |
50049012 |
T |
 |
| Q |
116 |
gtgcgtatatgccatactttccacatccacacagc-nnnnnnnnntgacaacccaactaggtgccgcaaggtattgactgcggcttagaccctttaggat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
50049011 |
gtgcgtatatgccatactttccacatccacacagcaaaaaaaaaatgacaacccaactaggtgccgcaaggtattgactatagcttagaccctttgggat |
50048912 |
T |
 |
| Q |
215 |
cgccgagactaatcattgactctgcaatggggcattcattttacacaccggaaattttaatactatcggtggattagtttatagttgttgtgttactctt |
314 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
50048911 |
cgccgagactaatcattgactctgcaat-gggcattcattttacacaccggaaattttaatactatctgtggattagtttatagttgttgtgttactctt |
50048813 |
T |
 |
| Q |
315 |
agtt |
318 |
Q |
| |
|
|||| |
|
|
| T |
50048812 |
agtt |
50048809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University