View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4429_low_5 (Length: 217)

Name: NF4429_low_5
Description: NF4429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4429_low_5
NF4429_low_5
[»] chr3 (1 HSPs)
chr3 (1-217)||(50048360-50048576)


Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 50048360 - 50048576
Alignment:
1 aattgttcagccattgcttgtcctattaaacaaaactgcaggtaaatctaggagacaaaaatcaagacagagtgaagtaactatttggtgtcaagataaa 100  Q
    |||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
50048360 aattgttcagccattgcttgtcctattaaacaaaactgaaagtaaatctaggagacaaaaatcaagacagagtgaagtaactatttagtgtcaagataaa 50048459  T
101 agggggtagacaaccaaacggaaccaaagtgattaactagcacgtttcatattcaaatggatgcaaactgaagacatacaaactaacaacaacgaatact 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50048460 agggggtagacaaccaaacggaaccaaagtgattaactagcacgtttcatattcaaatggatgcaaactgaagacatacaaactaacaacaacgaatact 50048559  T
201 tgattaaactaaattta 217  Q
    |||||||||||||||||    
50048560 tgattaaactaaattta 50048576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University