View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4429_low_5 (Length: 217)
Name: NF4429_low_5
Description: NF4429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4429_low_5 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 50048360 - 50048576
Alignment:
| Q |
1 |
aattgttcagccattgcttgtcctattaaacaaaactgcaggtaaatctaggagacaaaaatcaagacagagtgaagtaactatttggtgtcaagataaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
50048360 |
aattgttcagccattgcttgtcctattaaacaaaactgaaagtaaatctaggagacaaaaatcaagacagagtgaagtaactatttagtgtcaagataaa |
50048459 |
T |
 |
| Q |
101 |
agggggtagacaaccaaacggaaccaaagtgattaactagcacgtttcatattcaaatggatgcaaactgaagacatacaaactaacaacaacgaatact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50048460 |
agggggtagacaaccaaacggaaccaaagtgattaactagcacgtttcatattcaaatggatgcaaactgaagacatacaaactaacaacaacgaatact |
50048559 |
T |
 |
| Q |
201 |
tgattaaactaaattta |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
50048560 |
tgattaaactaaattta |
50048576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University