View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4430_high_12 (Length: 236)
Name: NF4430_high_12
Description: NF4430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4430_high_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 15 - 222
Target Start/End: Complemental strand, 31817600 - 31817397
Alignment:
| Q |
15 |
agtttgtgcacaagctcttcactaattttgacatgtctaacatggttgcaaaagataagtacagatctattttgcatgatgaagctgagaacatccattg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31817600 |
agtttgtgcacaagctcttcactaattttgacatgtctaacatggttgcaaaagataagtacagatctattttgcatgatgaagctgagaacatccattg |
31817501 |
T |
|
| Q |
115 |
gagacatggtggccctcccacatatggtcttgtcaaccagctctttgaagaaggaaggaccaaagtgaaaccacgtccacaccctcttaatcttattcct |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| ||||||||||||| ||| |
|
|
| T |
31817500 |
gagacatggtggccctcccacatatggtcttgtcaaccagctctttgaagaaggaaggaccaaagtg-aacca---ccacactctcttaatcttatccct |
31817405 |
T |
|
| Q |
215 |
tctcttcc |
222 |
Q |
| |
|
|||||||| |
|
|
| T |
31817404 |
tctcttcc |
31817397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 41 - 236
Target Start/End: Original strand, 31855363 - 31855558
Alignment:
| Q |
41 |
tttgacatgtctaacatggttgcaaaagataagtacagatctattttgcatgatgaagctgagaacatccattggagacatggtggccctcccacatatg |
140 |
Q |
| |
|
||||||||| ||||||| ||||||||||| ||||||||||| ||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |||| |
|
|
| T |
31855363 |
tttgacatggctaacatagttgcaaaagacaagtacagatcaattttgcatgatgaagctgagaatatccagtggagacatggtggccctcccacctatg |
31855462 |
T |
|
| Q |
141 |
gtcttgtcaaccagctctttgaagaaggaaggaccaaagtgaaaccacgtccacaccctcttaatcttattcc---ttctcttcctctttagattatac |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| ||||||| |||||||| ||| |||||||||| |
|
|
| T |
31855463 |
gtcttgtcaaccagctctttgaagaaggaaggaccaaagtgaaatca---ccacaccctcttaattttattccttattctcttcgtctctagattatac |
31855558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University