View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4431-Insertion-6 (Length: 418)
Name: NF4431-Insertion-6
Description: NF4431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4431-Insertion-6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 122; Significance: 2e-62; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 10 - 213
Target Start/End: Original strand, 8299504 - 8299713
Alignment:
| Q |
10 |
tacttggtgaattatatggtgaagtttaaactttgatggttagaatagnnnnnnnnnnnnnnnn-----aaatatgatttgataaaatatggtgcttact |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
8299504 |
tacttggtgaattatatggtgaagtttaaactttgatggttagaatagtttttttttttttttttttgtaaatatgatttgataaaatatggggcttact |
8299603 |
T |
|
| Q |
105 |
tgataactttgtgttttcctctcaatcattttactgtggttgcatgttttcaaaactcaccctttctttgtttgtgtttgt-tgccttaatccgcgtttg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
8299604 |
tgataactttgtgttttcctctcaatcattttactgtgattgcatgttttcaaaactcaccctttctttgtttgtatttgtctgccttaatccgcgtttg |
8299703 |
T |
|
| Q |
204 |
tgaaatcgca |
213 |
Q |
| |
|
|||||||||| |
|
|
| T |
8299704 |
tgaaatcgca |
8299713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 285 - 403
Target Start/End: Original strand, 8299895 - 8300014
Alignment:
| Q |
285 |
taccgtgaaatgactatt-aaaagtattttttctccattgtgaaatgcctgtcacaccattccttaccaatccttgattgcctatgcactattattgaga |
383 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8299895 |
taccgtgaaatgactatttaaaagtattttttctccattgtgaaatgcgtgtcacaccatttcttatcaatccttgattgcctatgcactattattgaga |
8299994 |
T |
|
| Q |
384 |
cttgaaagttgtctagcaag |
403 |
Q |
| |
|
|||||||||||||| ||||| |
|
|
| T |
8299995 |
cttgaaagttgtcttgcaag |
8300014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 148 - 185
Target Start/End: Original strand, 12097931 - 12097968
Alignment:
| Q |
148 |
atgttttcaaaactcaccctttctttgtttgtgtttgt |
185 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
12097931 |
atgttttcaaaactcacccattttttgtttgtgtttgt |
12097968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University